AllPairs: single sequence RNAbow

Mode
Input mode
Sequence (plain, FASTA, GenBank, etc.) [?]
Label
Method

Example

If you copy and paste the L. collosoma Spliced Leader sequence

AACUAAAACAAUUUUUGAAGAACAGUUUCUGUACUUCAUUGGUAUGUAGAGACUUC

into the sequence box, you will get the RNAbow diagram below.
RNAbows single RNAbow of full partition function A A C U A A A A C A A U U U U U G A A G A A C A G U U U C U G U A C U U C A U U G G U A U G U A G A G A C U U C G = -11.245 kcal/mol

Understanding the Output