BindOligoNet

Mode Single Batch
Entry Manual Entry Upload Sequences
s Sequence:
(oligo)
t Sequence:
(target)
Sequence Type: RNA DNA

Examples

  • Single mode matches one oligo s to one target t. For example, pasting C. elegans miRNA let-7 as s
    ugagguaguugguuguauagu
    and the lin-41 3' UTR as t
    1 acactttcttcttgctctttacccatttcagattgttttttaaaataatc 51 ttttgatcccttgatccttcttgcatctagagtacagttcaacttgtact 101 ttctttctttttcccccactcctagtcgatgatcggccccatcaaatcgg 151 gcgcaaagcacacacattccagaaatgttcccttttttccccccgagtat 201 tgtccttttccccttttctacacaggttaattaagagttatgtatttcat 251 atagtatttgtgtaatgtttattttcctgtgcttctacccggtagaacat 301 ccaaaaagctcccccgtccccccaaatccatgttccatctgtatatccca 351 gttttttgtctgttttatcttctctcgagcgcttcagccaaatccccttc 401 ccctcgtaattatccttgtttttcatacatttatgcaagttttctctcac 451 cattttaatggtttcccatccattcatatggctccgccccttccctgtgc 501 actttttatctgaaaattctttgatatttagagaaatttgagaatatttc 551 gatgagattcatgtaggtttttccaaaaaatcgaacgaattttgtcggaa 601 tatttgaaatctcaggaaaagtctaaagaattaaaacacccacaatagca 651 cctcttttcctcaaattgcaccaactcaagtataccttttatacaaccgt 701 tctacactcaacgcgatgtaaatatcgcaatccctttttatacaaccatt 751 ctgcctctgaaccattgaaaccttctcccgtactcccaccaatagattat 801 tgcacttttctgagagtttttctgtgttggaatcataattttctaaactg 851 attcgcataatttccaacactgaaaaactttctcaacacctctggtgact 901 attttcttttccggtgttaattgtcccaattgcctaatgtccccagtgtt 951 catttaagctccccatttatttttatttcactgtcttggtttttgtgccc 1001 tagcgctaaatattgttttattttaatgcatgcttcctgcacgcccctcc 1051 cccttcttgcgcacccaattttacaacaatttgtaatttaaattcgcaaa 1101 tttcactgcgaaatt
    produces net free energy minimum, optimal alignment (paired bases are capitalized), and free energy landscape:
    ΔGmin = -19.63 kcal/mol 
    3'         uGAUAUGUUGGUu*GAUGGAGu    5'
730-aucccuuuUUAUACAACCAuuCUGCCUCuga-760
    		Save [-]
    -0.00-6.54-13.09-19.63
    In the above example, let-7 is complementary to two regions in lin-41. Both binding sites and the 27 base spacer are evident in the ΔG(j) plot between 690-757.

  • Batch mode evaluates many s/t net bindings, separated by linebreaks. It is possible to pair one oligo with many targets or n oligos with n targets. If s is the U1 snRNA sequence
    auacuuaccuggc
    and t is a list of 3 donor splice sites with 30-mer flanks surrounding the consensus GT
    gacccttcctaggaccagagagtcagctggGTaagtgacagcttctcaggtttggtggctct
    tttccacaaagatgttattgcagagatgagGTgagtatacttttgctttgtgtcatatatgc
    ggtgaagtgctccgccgcccttgcctccagGTagccggcttgggggagtgggccaggagcgg
    then BindigoNet produces
    ΔGmin = -8.9 kcal/mol 
    3'       CGGUCCAUUCAua   5'
20-gagucaGCUGGGUAAGUgaca-40
    		Save [-]
    -0.00-2.97-5.93-8.90
    ΔGmin = -8.25 kcal/mol 
    3'       cggUCCAUUCAUA   5'
20-gcagagaugAGGUGAGUAUac-40
    		Save [-]
    -0.00-2.75-5.50-8.25
    ΔGmin = -7.06 kcal/mol 
    3'       cGGUCCAUucaua   5'
20-cuugccuCCAGGUAgccggcu-40
    		Save [-]
    -0.00-2.35-4.71-7.06

    Input

    Sequences can be entered either in single mode or batch mode. In single mode, both sequences can be entered either in plain, FASTA, GenBank, or RNAstructure formats [details]. There are two batch modes. In multiple oligos to multiple targets mode, each sequence must be put on its own line and BindOligoNet will compute interactions between s and t sequences on the same numbered line. In single oligo to multiple targets mode, the same s sequences is paired to multiple targets.

    Classic Bindigo

    Bindigo 2004 functionality is accessible at bindigo.html.

    To Download BindOligoNet

    In addition to this web interface, we offer a command-line based standalone version available on our GitHub repository.